Concatenated logic gates by amplified chemiluminescence of hemin/G-Quadruplex DNAzyme based on a nonlinear hybridization chain reaction

A nonlinear hybridization chain reaction (non L-HCR) is presented here, in which series of toehold-mediated strands hybridization and branch migration reaction initiate in the presence of a trigger DNA. It leads to self-sustained assembly of double-stranded substrates into fractal nanostructures. The formed fractal nanostructures were about 10   μm length   ×   1.5   μm wide   ×   30   nm high. Furthermore, the 3′ part (TAGGGTTGGGCGGGATGGGT) of Gx DNA are exposed and ready to combined with hemin to form hemin/G-quadruplex DNAzyme, which could amplify the generation of chemiluminescence (CL) in the presence of luminol and H 2 O 2 . Under optimal conditions, the CL intensity linearly increased with the concentration of the trigger DNA from 0.5   ×   10 −6 to 1.0   ×   10 −11   M and the detection limit is 7.0   ×   10 −12   M. In this assay, three-input concatenated logic gates operating as a biocomputing keypad-lock security system also have been successfully constructed. When the inputs are all introduced the “lock” opens. This simple non L-HCR design realizes the fractal nanostructures construction, CL detection and logic gates operating. It can be used in the nanotechnology and biological assay.